First report of Rice yellow mottle virus on rice in the Democratic Republic of Congo

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo...

Full description

Bibliographic Details
Main Authors: Hubert, J.G., Pinel Galzi, A., Dibwe, D., Cinyabuguma, E., Kaboré, A., Fargette, D., Silué, D., Hébrard, E., Séré, Y.
Format: Journal Article
Language:Inglés
Published: Scientific Societies 2013
Subjects:
Online Access:https://hdl.handle.net/10568/115304
_version_ 1855534059856330752
author Hubert, J.G.
Pinel Galzi, A.
Dibwe, D.
Cinyabuguma, E.
Kaboré, A.
Fargette, D.
Silué, D.
Hébrard, E.
Séré, Y.
author_browse Cinyabuguma, E.
Dibwe, D.
Fargette, D.
Hubert, J.G.
Hébrard, E.
Kaboré, A.
Pinel Galzi, A.
Silué, D.
Séré, Y.
author_facet Hubert, J.G.
Pinel Galzi, A.
Dibwe, D.
Cinyabuguma, E.
Kaboré, A.
Fargette, D.
Silué, D.
Hébrard, E.
Séré, Y.
author_sort Hubert, J.G.
collection Repository of Agricultural Research Outputs (CGSpace)
description Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC.
format Journal Article
id CGSpace115304
institution CGIAR Consortium
language Inglés
publishDate 2013
publishDateRange 2013
publishDateSort 2013
publisher Scientific Societies
publisherStr Scientific Societies
record_format dspace
spelling CGSpace1153042024-04-25T06:01:28Z First report of Rice yellow mottle virus on rice in the Democratic Republic of Congo Hubert, J.G. Pinel Galzi, A. Dibwe, D. Cinyabuguma, E. Kaboré, A. Fargette, D. Silué, D. Hébrard, E. Séré, Y. rice plant diseases viruses Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. 2013-12 2021-10-05T13:36:49Z 2021-10-05T13:36:49Z Journal Article https://hdl.handle.net/10568/115304 en Open Access Scientific Societies Hubert, J.G. Pinel-Galzi, A. Dibwe, D. Cinyabuguma, E. Kaboré, A. Fargette, D. Silué, D. Hébrard, E. Séré, Y.First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo.Plant Disease.2013, Volume 97, Issue 12:1664.
spellingShingle rice
plant diseases
viruses
Hubert, J.G.
Pinel Galzi, A.
Dibwe, D.
Cinyabuguma, E.
Kaboré, A.
Fargette, D.
Silué, D.
Hébrard, E.
Séré, Y.
First report of Rice yellow mottle virus on rice in the Democratic Republic of Congo
title First report of Rice yellow mottle virus on rice in the Democratic Republic of Congo
title_full First report of Rice yellow mottle virus on rice in the Democratic Republic of Congo
title_fullStr First report of Rice yellow mottle virus on rice in the Democratic Republic of Congo
title_full_unstemmed First report of Rice yellow mottle virus on rice in the Democratic Republic of Congo
title_short First report of Rice yellow mottle virus on rice in the Democratic Republic of Congo
title_sort first report of rice yellow mottle virus on rice in the democratic republic of congo
topic rice
plant diseases
viruses
url https://hdl.handle.net/10568/115304
work_keys_str_mv AT hubertjg firstreportofriceyellowmottlevirusonriceinthedemocraticrepublicofcongo
AT pinelgalzia firstreportofriceyellowmottlevirusonriceinthedemocraticrepublicofcongo
AT dibwed firstreportofriceyellowmottlevirusonriceinthedemocraticrepublicofcongo
AT cinyabugumae firstreportofriceyellowmottlevirusonriceinthedemocraticrepublicofcongo
AT kaborea firstreportofriceyellowmottlevirusonriceinthedemocraticrepublicofcongo
AT fargetted firstreportofriceyellowmottlevirusonriceinthedemocraticrepublicofcongo
AT silued firstreportofriceyellowmottlevirusonriceinthedemocraticrepublicofcongo
AT hebrarde firstreportofriceyellowmottlevirusonriceinthedemocraticrepublicofcongo
AT serey firstreportofriceyellowmottlevirusonriceinthedemocraticrepublicofcongo