Resultados de búsqueda - "proteins"

Masked genotype 6 of bovine leukemia virus is found in colombian cattle por Corredor Figueroa, Adriana Patricia, Olaya Galán, Nury Nathalia, Salas, Sandra Patricia, Quintero, Juan Sebastián, Fajardo, Álvaro, Soñora, Martín, Moreno, Pilar, Cristina, Juan, Sánchez, Alfredo, Tobón, Julio, Ortiz, Diego, Gutierrez, María Fernanda

Enlace del recurso
Enlace del recurso
Enlace del recurso

Comparative study on the in vitro replication and genomic variability of Argentinean field isolates of bovine herpesvirus type 4 (BoHV-4) por Verna, Andrea Elizabeth, Perez, Sandra, Manrique, Julieta Marina, Leunda, Maria Rosa, Odeon, Anselmo Carlos, Jones, Leandro Roberto

“…The most conserved gene was the major capsid protein (ORF25). The glycoprotein B (gB), glycoprotein H (gH), and thymidine kinsase (TK) genes displayed both synonymous and nonsynonymous substitutions, with the highest diversity observed for gB, which displayed amino acid substitutions in 24 out of the 178 positions examined. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

Forage Accumulation and Quality of Three Contrasting Ecotypes of Tall Fescue (Schedonorus arundinaceus) Managed under Frequent Defoliation por Mattera, Juan, Scheneiter, Jorge Omar, Cattoni, María Isabel, Pacente, Ezequiel Martin, Barletta, Pablo Fernando, Bertin, Oscar Dario

“…A sample (0.250 g) was taken to analyze in vitro dry matter digestibility (IVDIG), crude protein (CP), neutral detergent fiber (NDF) and NDF digestibility (NDFDIG). …”
Enlace del recurso
Enlace del recurso

First report of cowpea mild mottle virus in chia (Salvia hispanica) por Celli, Marcos Giovani, Perotto, Maria Cecilia, Merino, Maria Alicia, Nome Docampo, Claudia, Flores, Ceferino Rene, Conci, Vilma Cecilia

“…Nucleotide (nt) sequence of the coat-protein gene (CP – ORF5) of the chia virus isolate was obtained and compared with 31 CPMMV sequences reported in GenBank. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

Quantitative trait loci exploration and characterization of gestation length in Holstein cattle por Raschia, Maria Agustina, Maizon, Daniel Omar, Amadio, Ariel, Nani, Juan Pablo, Poli, Mario Andres

“…Regarding the effect of GL on production performance, cows with gestation periods within ±1.5 SD from the population mean exhibited the highest 305-day cumulative milk, fat, and protein productions. Direct and maternal heritabilities for GL were 0.42 and 0.03, respectively. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

Early to late VSV-G expression in AcMNPV BV enhances transduction in mammalian cells but does not affect virion yield in insect cells por Simonin, Jorge Alejandro, Cuccovia Warlet, Franco Uriel, Bauzá, María del Rosario, Plastine, María Del Pilar, Alfonso, Victoria, Olea, Fernanda Daniela, Cerrudo, Carolina Susana, Belaich, Mariano Nicolás

“…While pseudotyping with vesicular stomatitis virus G-protein (VSV-G) enhances transduction efficiency, optimal expression strategies during the Autographa californica multiple nucleopolyhedrovirus (AcMNPV) infection cycle remain unexplored. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

Pre-existing anti-inflammatory immune conditions influence early antibody avidity and isotype profile following Comirnaty® vaccination in mice por Castillo, Mariangeles, Miraglia, Maria Cruz, Mansilla, Florencia Celeste, Randazzo, Cecilia Paola, Bentancor, Leticia Veronica, Freire, Teresa, Capozzo, Alejandra

“…Methods: BALB/c mice were pretreated with a F. hepatica protein extract (FH) or complete Freund’s adjuvant (CFA) prior to vaccination. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

TunR2, a novel mode-of-action tunicamycin-type antibiotic : Pharmacokinetics in C57BL/6 mouse and Holstein cattle por Colombatti Olivieri, Maria Alejandra, Cassmann, Eric D., Jackson, Michael A., Price, Neil P. J., Bannantine, John P.

“…TunR2 has previously been shown to be effective in a mycobacterial disease model using zebrafish, with a minimal activation of the eukaryotic unfolded protein response (upr) and a reduction in the in vivo mycobacterial burden. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

Measurement of malondialdehyde as oxidative stress biomarker in goat plasma by HPLC-DAD por Yonny, Melisa Evangelina, García, Elisa Mariana, Lopez, Agustin, Arroquy, Jose Ignacio, Nazareno, Mónica Azucena

“…Free MDA (FMDA) was directly quantified after TBA condensation; while, Protein-bound MDA (PBMDA) needed to be released by an alkaline hydrolysis step and followed by TBA condensation. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

Regulation of Zn and Fe transporters by the GPC1gene during early wheat monocarpic senescence por Pearce, Stephen, Tabbita, Facundo, Cantu, Dario, Buffalo, Vince, Avni, Raz, Vazquez Gross, Hans, Zhao, Rongrong, Conley, Christopher J., Distelfeld, Assaf, Dubcovsky, Jorge

“…We have previously shown that the simultaneous downregulation of Grain Protein Content (GPC) transcription factors, GPC1 and GPC2, greatly delays senescence and disrupts nutrient remobilization, and therefore provide a valuable entry point to identify genes involved in micronutrient transport to the wheat grain. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

Detection of bovine herpesvirus 2 and bovine herpesvirus 4 DNA in trigeminal ganglia of naturally infected cattle by polymerase chain reaction por Campos, Fabrício Souza, Franco, Ana Cláudia, Oliveira, Martha Trindade, Firpo, R.M., Strelczuk, G., Fontoura, F.E., Kulma, Marcos Iuri Roos, Maidana, Silvina Soledad, Romera, Sonia Alejandra, Spilki, Fernando, Silva, Alessandra D. Avila, Hübner, Sílvia De Oliveira, Roehe, Paulo Michel

“…Total DNA extracted from ganglia was analyzed by polymerase chain reaction (PCR) designed to amplify part of the genes coding for BoHV-2, and BoHV-4 glycoprotein B and, for OvHV-2, the gene coding for phosphoribosylformylglycinamidine synthase-like protein. BoHV-2 DNA was detected in TG samples of two (2%) and BoHV-4 DNA in nine (9%) of the animals, whereas OvHV-2 DNA could not be detected in any of the TG DNA. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

Development and evaluation of a double-antigen sandwich ELISA to identify Anaplasma marginale–infected and A. centrale–vaccinated cattle por Sarli, Macarena, Thompson, Carolina Soledad, Novoa, María Belen, Valentini, Beatriz Susana, Mastropaolo, Mariano, Echaide, Ignacio Eduardo, Torioni, Susana Marta, Primo, María Evangelina

“…We developed 3 variants of a double-antigen sandwich ELISA (dasELISA) using a recombinant major surface protein 5 (MSP5) from A. marginale (dasELISAm) or from A. centrale (dasELISAc) or using MSP5 from both organisms (dasELISAmc). …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

First report of Papaya ringspot virus infecting Carica papaya in Argentina por Cabrera Mederos, Dariel, Dal Zotto, Angelica, Galdeano, E., Portal, O., Giolitti, Fabian

“…Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and tested by reverse transcription-polymerase chain reaction (RT-PCR) with specific PRSV coat protein gene primers: BoCP_Fwd 5’-TCCAAGAATGAAGCTGTGGACGCTGGTT-3’ and BoCP_Rev 5’-TYAGTTGCGCATACCCAGGAGAGAGT-3’. …”
Enlace del recurso
Enlace del recurso
Enlace del recurso

Nötkreaturens val av betesvegetation på naturliga betesmarker por Pelve, Maja

“…The contents of energy, organic substance and crude protein in the herbage from these sub-areas were the highest, and the fibre content was lowest. …”

Possibilities of three Swedish wild grown macroalgae por Andersson, Lisa

“…U. lactuca is one of few species from the non-animal source that is rich in Vitamin B12, S. latissima is rich in dietary fibre and may be useful against obesity and P.palmata is rich in iodine and protein, and has an amino acid profile that can be better than chicken.…”
Enlace del recurso

Towards a better understanding of breeding objectives and production performance of dairy cattle in sub-Saharan Africa: A systematic review and meta-analysis por Chawala, A.R., Okeyo Mwai, Ally, Peters, A., Banos, Giorgios, Chagunda, Mizeck G.G.

“…Milk content (fat and protein percentages), temperament, body conformation and total milk cell count (a mastitis indicator) were rarely mentioned in published literature, mainly because of milk pricing policies being volume based. …”
Enlace del recurso

Assessment of botanical composition, biomass yield, nutritional quality and methane production of forages in selected grasslands, southern highlands of Ethiopia por Mosisa, A., Nurfeta, A., Bezabih, Melkamu, Tolera, Adugna, Mengistu, S., Yigrem, S., Hassen, A.

“…The ranges of chemical constituents for grasses were 8.44–10.74%, 52.8–72%, 27.7–37.4%, 3.1–5.6%, 58.2–76% for crude protein (CP), neutral detergent fiber (NDF), acid detergent fiber (ADF), acid detergent lignin (ADL) and in vitro dry matter digestibility (IVDMD), respectively. …”
Enlace del recurso

First Report of Rice yellow mottle virus on Rice in Burundi por Ndikumana, I., Pinel Galzi, A., Negussie, Z., Msolla, S.N., Njau, P., Singh, R.K., Choi, I.R., Bigirimana, J., Fargette, D., Hébrard, E.

“…Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). …”
Enlace del recurso

Morpho-biochemical characterization of a RIL population for seed parameters and identification of candidate genes regulating seed size trait in lentil (Lens culinaris Medik.) por Dutta, Haragopal, K. M, Shivaprasad, Aski, Muraleedhar, Mishra, Gyan, Sinha, Subodh Kumar Sinha, Vijay, Dunna, Prasad C. T, Manjunath, Das, Shouvik, Anupama-Mohan Pawar, Prashant, Mishra, Dwijesh C, Singh, Amit, Kumar, Atul, Tripathi, Kuldeep, Kumar, Ranjeet Ranjan, Gupta, Sanjeev, Agrawal, Shiv Kumar, Dikshit, Harsh

“…Afterward, the nearby region on chromosome 3 was searched, and a few candidate genes like ubiquitin carboxyl-terminal hydrolase, E3 ubiquitin ligase, TIFY-like protein, and hexosyltransferase having a role in seed size determination were identified. …”
Enlace del recurso

Biomass yield, nutritional value and in vitro ruminal fermentation kinetics of Guatemala grass (Tripsacum laxum) at different harvesting stages and agro-ecologies in southern Ethio... por Aba Jebel, Abdo

“…Guatemala grass from mid- agro-ecologies yielded significantly higher (p<0.05) crude protein (CP) content and. The result also showed that delaying the harvesting stage led to an increase in fiber content, but insignificant (P>0.05) a decrease (P) in CP, ME, IVOMD. …”
Enlace del recurso