Search Results - "proteins"

Refine Results
  1. Wool loss in sheep by Fors, Maria

    Published 2013
    “…Low temperature in combination with shearing was believed to cause the wool loss the first year, while protein deficiency was believed to be the cause the second year. …”
    H2
  2. Influence of temperature on selected life-history traits of black soldier fly (Hermetia illucens) reared on two common urban organic waste streams in Kenya by Shumo, M., Khamis, F.M., Tanga, C.M., Fiaboe, K.K.M., Subramanian, S., Ekesi, S., Huis, A. van, Borgemeister, C.

    Published 2019
    “…Insects such as the black soldier fly (BSF) have been identified as potential alternatives to the conventionally used protein sources in livestock feed due to their rich nutrient content and the fact that they can be reared on organic side streams. …”
    Get full text
    Journal Article
  3. Methods and guidance to support MRV of livestock emissions: Methods for data collection, analysis and summary results from a pilot baseline survey for the Kenya dairy NAMA by Wilkes, Andreas, Odhong’, Charles, Dijk, Suzanne van, Fraval, Simon, Wassie, Shimels Eshete

    Published 2019
    “…Analysis of the survey data following the Smallholder Dairy Methodology’s requirements shows that the relationship between GHG intensity (kg CO2e/kg fat and protein corrected milk [FPCM]) and milk yield (kg FPCM per farm per year) can be represented by a power regression: y = 81.868x-0.436. …”
    Get full text
    Artículo preliminar
  4. Genetic mapping for agronomic traits in a MAGIC population of common bean (Phaseolus vulgaris L.) under drought conditions by Díaz, Santiago, Ariza-Suárez, Daniel, Izquierdo, Paulo, Lobaton, Juan David, Hoz, Juan Fernando de la, Acevedo, Fernando, Duitama, Jorge, Guerrero, Alberto F., Cajiao V., César Hernando, Mayor, Victor, Beebe, Stephen E., Raatz, Bodo

    Published 2020
    “…Particularly smallholder farmers rely on bean as a source for calories, protein and micronutrients. Drought is a major production constraint for common bean, a situation that will be aggravated with current climate change scenarios. …”
    Get full text
    Journal Article
  5. Apparent nitrogen recovery in milk and early dry season nitrous oxide emission factors for urine deposited by dual-purpose cattle on different soil types by Durango Morales, Sandra Guisela, Barahona Rosales, Rolando, Bolívar Vergara, Diana María, Arango, Jacobo, Verchot, Louis V., Chirinda, Ngonidzashe

    Published 2021
    “…Dry matter intake (DMI) by the cattle was estimated using the Cornell Net Carbohydrate and Protein System. We used a closed static chamber technique to measure N2O emissions from soils in areas with and without urine patches (21 days in Atlántico and 35 Days in Casanare). …”
    Get full text
    Journal Article
  6. Yield and nutritional quality of sweet lupine (Lupinus angustifolius) grown in Midaltitudes of Lemo District, Hadiya Zone, Southern Ethiopia by Tessema, Fikadu, Shawel, K., Bezabih, Melkamu

    Published 2021
    “…Sweet lupine forage in Upper Gana Kebele gave the highest crude protein (CP) content (23.11%) while the highest forage CP content was recorded at a planting space of 40 cm × 20 cm (23.67%). …”
    Get full text
    Journal Article
  7. Understanding variability in greenhouse gas emission estimates of smallholder dairy farms in Indonesia by Apdini, Titis, Al Zahra, Windi, Oosting, Simon J, Boer, Imke J.M. de, Vries, Marion de, Engel, Bas, Middelaar, Corina E.M. van

    Published 2021
    “…We compared means of GHGE per unit of fat-and-protein-corrected milk (FPCM) produced in the rainy and the dry season. …”
    Get full text
    Journal Article
  8. Enteric methane mitigation strategies for ruminant livestock systems in the Latin America and Caribbean region: A meta-analysis by Souza Congio, Guilhermo Francklin de, Bannink, André, Mayorga Mogollón, Olga Lucía, Latin America Methane Project Collaborators, Arango, Jacobo, Gaviria Uribe, Xiomara

    Published 2021
    “…Adequate strategies of grazing management under continuous and rotational stocking decreased CH4 emission per ADG (CH4IGain) by 22 and 35%, while increasing ADG by 22 and 71%, respectively. Increased dietary protein concentration, and increased concentrate level through cottonseed meal inclusion, decreased CH4IMilk and CH4IGain by 10 and 20% and increased MY and ADG by 12 and 31%, respectively. …”
    Get full text
    Journal Article
  9. Income, consumer preferences, and the future of livestock-derived food demand by Komarek, Adam M., Dunston, S., Enahoro, Dolapo K., Godfray, H. Charles J., Herrero, Mario, Mason-D'Croz, Daniel, Rich, Karl M., Scarborough, Peter, Springmann, M., Sulser, Timothy B., Wiebe, Keith D., Willenbockel, Dirk

    Published 2021
    “…We used scenario-based modeling to show that average protein demand for red meat (beef, sheep, goats, and pork), poultry, dairy milk, and eggs across the globe would increase by 14% per person and 38% in total between the year 2020 and the year 2050 if trends in income and population continue along a mid-range trajectory. …”
    Get full text
    Journal Article
  10. First report of Rice yellow mottle virus on rice in the Democratic Republic of Congo by Hubert, J.G., Pinel Galzi, A., Dibwe, D., Cinyabuguma, E., Kaboré, A., Fargette, D., Silué, D., Hébrard, E., Séré, Y.

    Published 2013
    “…The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (1). …”
    Get full text
    Journal Article
  11. Assessment of feed resources for ruminant production in northern region of Ghana by Wachiebene, S.K.

    Published 2021
    “…Moreover, leaf stripping by maize-maturity type’s interaction and its main effects had no significant effect on crude protein, neutral detergent fibre, acid detergent fibre, metabolizable energy, and in vitro organic matter digestibility The study recommends that crop-livestock farmers are encouraged to cultivate groundnut at a spacing of 30x15cm to obtain the highest results with regards to fodder yield, grain yield and growth performance of sheep. …”
    Get full text
    Tesis
  12. Physiological responses and transcriptomic changes reveal the mechanisms underlying adaptation of Stylosanthes guianensis to phosphorus deficiency by Chen, Zhijian, Song, Jianling, Li, Xinyong, Arango, Jacobo, Cardoso, Juan Andrés, Rao, Idupulapati M., Schultze-Kraft, Rainer, Peters, Michael, Mo, Xiaohui, Liu, Guodao

    Published 2021
    “…Subsequent RNA-seq analysis revealed 8,348 genes that were differentially expressed under P deficient and sufficient conditions in RY2 roots, with many Pi starvation regulated genes associated with P metabolic process, protein modification process, transport and other metabolic processes. …”
    Get full text
    Journal Article
  13. Insights in the global genetics and gut microbiome of black soldier fly, Hermetia illucens: implications for animal feed safety control by Khamis, F.M., Ombura, F.L., Akutse, K.S., Subramanian, S., Mohamed, S.A., Fiaboe, K.K., Saijuntha, W., Loon, Jelle J. van, Dicke, M., Dubois, T., Ekesi, S., Tanga, C.M.

    Published 2020
    “…The utilization of the black soldier fly (BSF) Hermetia illucens L. for recycling organic waste into high-quality protein and fat biomass for animal feeds has gained momentum worldwide. …”
    Get full text
    Journal Article
  14. Molecular survey of Babesia parasites in Kenya: first detailed report on occurrence of Babesia bovis in cattle by Githaka, Naftaly W., Bishop, Richard P., Šlapeta, J., Emery, D., Nguu, E.K., Kanduma, E.G.

    Published 2022
    “…A sub-set of 29 B. bovis real-time PCR-positive samples were further amplified using a B. bovis-specific spherical body protein-4 (SBP-4) nested PCR and the resulting products sequenced to confirm the presence of B. bovis. …”
    Get full text
    Journal Article
  15. Assessing the nutritional quality of stored grain legume fodders: correlations among farmer perceptions, sheep preferences, leaf-stem ratios and laboratory analyses by Akakpo, D.B., Boer, I.J.M. de, Giller, Kenneth E., Adjei-Nsiah, S., Duncan, Alan J., Oosting, S.J.

    Published 2022
    “…In this study, therefore, we assessed the nutritional quality of GLFs as affected by storage conditions using four different methods: farmers’ perception score (FPS), sheep preference score (SPS), leaf-to-stem ratio (LSR), and laboratory analysis of organic matter digestibility (OMD), crude protein content, neutral detergent fibre (NDF) and acid detergent fibre (ADF). …”
    Get full text
    Journal Article
  16. Weight gain and enteric methane production of cattle fed on tropical grasses by Korir, Daniel, Marquardt, Svenja, Eckard, Richard, Sánchez, Andrea C., Dickhoefer, Uta, Merbold, Lutz, Butterbach-Bahl, Klaus, Jones, Christopher S., Robertson-Dean, M., Goopy, John P.

    Published 2023
    “…However, suitable feeding practices such as protein supplementation need to be explored to enhance ruminant production and reduce enteric CH4 production.…”
    Get full text
    Journal Article
  17. Variation in grain zinc and iron concentrations, grain yield and associated traits of biofortified bread wheat genotypes in Nepal by Dhruba Bahadur Thapa, Subedi, Mahesh, Yadav, Rajendra Prasad, Joshi, Bishnu Prasad, Adhikari, Bhim Nath, Shrestha, Keshav Prasad, Magar, Prem Bahadur, Pant, Khem, Gurung, Suk Bahadur, Ghimire, Sapana, Gautam, Nutan Raj, Acharya, Nav Raj, Sapkota, Manoj, Vinod Kumar Mishra, Joshi, Arun Kumar, Singh, Ravi P., Velu, Govindan

    Published 2022
    “…Wheat (Triticum aestivum L.) is one of the major staples in Nepal providing the bulk of food calories and at least 30% of Fe and Zn intake and 20% of dietary energy and protein consumption; thus, it is essential to improve its nutritional quality. …”
    Get full text
    Journal Article
  18. Characterization of faba bean and chickpea viruses causing yellowing and stunting symptoms in Tunisia by Mghandef, Samia, Kumari, Safaa, Najar, Asma

    Published 2022
    “…Molecular results showed that BWYV and CpCSV (both belong to genus Polerovirus, family Solemoviridae) and BLRV (belong to genus Luteovirus, family Tombusviridae) were identified in Tunisia, and the coat protein nucleotide sequence analysis of the Tunisian isolates showed 99% homology to Moroccan isolate (CpCSV), 97% homology to the French isolate (BWYV), and 98% homology to Argentina isolate (BLRV).…”
    Get full text
    Conference Paper
  19. The carbon footprint of young-beef cattle finishing systems in the Eastern Plains of the Orinoco River Basin of Colombia by Ramírez Restrepo, Carlos Alberto, Vera-Infanzón, Raul R., Rao, Idupulapati M.

    Published 2023
    “…Depending on the fattening strategy, kg CO2-eq CH4/kg edible protein values ranged from 66.843 to 87.488 ± 0.497 for heifers and from 69.689 to 91.291 ± 0.446 for steers. …”
    Get full text
    Journal Article
  20. Proximate composition and vitamin A contribution of biofortified orange fleshed sweet potato value added products by Wafula, E.N., Malavi, D.N., Mbogo, D., Mwaura, L., Moyo, M., Muzhingi, T.

    Published 2022
    “…The moisture content, total ash, crude fiber, crude fat, crude protein, and carbohydrate content of the OFSP products varied between 2.4-29.7%, 0.7-2.4%, 1.0-4.5%, 0.7-18.1%, 5.1-7.9% and 50.7-83.7%, respectively. …”
    Get full text
    Journal Article

Search Tools: